FastQCFastQC Report
Tue 15 Mar 2016
19-Normal8A2Muscle_131203_L004_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename19-Normal8A2Muscle_131203_L004_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20723620
Sequences flagged as poor quality0
Sequence length10-100
%GC37

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCAGGTGGGAGATTTTGATATCATTCTAAAGAACTATTTAAGTTTATAGA254960.12302869865399964No Hit
CATAGTTTATGTATTATGGGATTAATTAAAAAATATATAAAGTATATGAT216830.10462940355015196No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATAATCG136850.053.76868494
CCCCCGA36750.038.3401451
AGGTGGG77350.037.342613
GGTGGGA94550.036.2309074
ATCTAGA109750.035.735829
GCCCCGT21950.035.5058481
CGTGCTC71900.034.19797594
CCCGCCG36800.033.07730594
GTGGGAG104150.033.031875
CCCCGAT32250.032.7674522
GGGAGAT122650.032.744427
CATCTAG123600.031.613058
GGAGATT130850.030.704068
TAAGCGT116000.029.45077582-83
CCCCGTT35900.029.4359442
AATCGGA52750.029.190894
GGTGTGC76750.028.8799676
TACACCG32900.028.4887194
GGTATAT267550.028.48048294
ATAAGCG120500.028.39430282-83