FastQCFastQC Report
Tue 15 Mar 2016
19-Normal8A2Muscle_131203_L004_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename19-Normal8A2Muscle_131203_L004_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20723620
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG1711630.825931955903457No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC787520.3800108282240265No Hit
CGATGTTGGATTAAGAAAATTATTAGGTGCAGAAGCTTAATTTATTGGTC591650.28549548775744776No Hit
AGCTGGTATACCACGACGGTACTCCGATTATCCAGACGCTTATACTTCAT420150.20273967579023355No Hit
GGAATAGTAGGTACATCTTTAAGTATTTTAATTCGAACAGAATTAGGACA342090.1650725114627657No Hit
AAAAGGTGAAGTAGTAGTAATTAGTTTTATACAATAAAATTGTTTTTGAT309240.14922103377691737No Hit
GCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTGG296340.14299625258521437No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT211960.10227942801498965No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAGCTTA194250.051.43290394
GCGGTCT52100.042.88985494
CAGGAGG385700.042.5258753
GTGAGCC77850.041.922194
TGCAGGA386200.041.8250921
GAGGTGA398450.040.6025289
GCAGGAG401600.040.365562
AGGAGGT411000.039.0447737
GGAGGTG417950.038.5042048
GAAACCC214900.036.015892
AATTTCT591300.034.30993794
CGCAACG50700.030.5142271
CCCAAAG257450.030.3856566
GGAGGAG550850.030.3596765
CAGGCTT351250.030.12356680-81
ACCAGGC349100.030.1010278-79
GGTGACC314150.030.02948810-11
AGGGACC49200.029.717417
CGATGTT187700.029.714871
AGGAGGA555800.029.2864174