FastQCFastQC Report
Tue 15 Mar 2016
19-Normal8A2Muscle_131203_L004_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename19-Normal8A2Muscle_131203_L004_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences240473
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG6190.2574093557280859No Hit
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG3290.13681369634012966No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC3080.12808090721203627No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC2470.10271423403043169No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT351.5886624E-596.7127894
CCGCCAT1150.051.52503654-55
TCTACGT450.00854754449.797688-89
TTCAGCC1700.047.859381
ATGGCCT1950.040.1181838
ATCGCGG709.822543E-1139.115864-65
GCAGAGC1305.6818644E-639.0570994
ATCAGCT1058.971052E-539.01526392-93
CAGCCAT2050.037.939013
CCGTGGC950.037.67512542-43
CGGTTGA501.1084246E-437.66260588-89
AGCCATG2350.037.6087844
GCCATGG2200.037.0207635
CGGCTGT702.744855E-936.8046868-69
CAGCTTA1151.2667784E-436.7929194
GACCGGT501.321786E-436.55321586-87
AAATCGG704.6342166E-436.26729694
CATGGCC2200.035.522157
TCAGCCA2400.035.3743252
CCATGGC2250.034.682046