FastQCFastQC Report
Tue 15 Mar 2016
18-Normal8A2Head_131203_L004_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename18-Normal8A2Head_131203_L004_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22255296
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT472300.21221914999467992No Hit
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT237800.10685097156200483No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GGTGTGC125150.037.4728136
CCTGACC86000.036.4624943
GTGTGCT174100.033.9117667
CTGACCT95600.033.3998834
TGACCTA99150.032.394585
GTGCTCT192350.030.5817479
TGTGCTC198600.029.7620078
GCCTAAC45150.029.2636412
GACCTAA116600.027.8595716
CCCGCCG44800.027.68891794
CCGATCT135300.026.35701816-17
GGTCCGA19900.025.893911
GCCCCGT25650.025.2403181
CCCCGAT28450.024.9234682
GGGTGTG105250.024.865775
ATAATCG95800.024.69095694
ATACGCC37950.023.004997
CCCCGTA26600.022.352032
TTCCGAT163500.022.26465814-15
GGGCCGT28300.021.3205781