FastQCFastQC Report
Tue 15 Mar 2016
18-Normal8A2Head_131203_L004_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename18-Normal8A2Head_131203_L004_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22255296
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT572450.2572196748135815No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG514780.2313067415504157No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT483800.21738645938476847No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC263930.11859199715878863No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT28600.042.33300494
CGCAACG62500.033.2531131
CAGCTTA123950.025.69985694
CAGGAGG221950.024.6888123
CGACCGA40000.022.8518686
GCCGGGG57100.022.5665513
GCAACGA97400.022.1621972
GAGGTGA232500.021.9224559
GCAGGAG246700.021.6035522
ACCAGGC156850.021.47006478-79
AGGAGGT239200.021.120517
ACCGAGC43700.020.8161778
GTCATCC150950.020.68117350-51
CCGGGGA62700.020.6221034
CGATGAT104700.020.5697156
TGCAGGA258350.020.4567341
CTCTACC151750.020.23376722-23
CAACGAT106450.019.8115713
GGAGGTG260150.019.6432368
GGTGACC155050.019.61605510-11