FastQCFastQC Report
Tue 15 Mar 2016
17-Normal21A1Testis_131203_L004_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename17-Normal21A1Testis_131203_L004_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22526496
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT568120.2522007861320287No Hit
GACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT230140.10216413595794038No Hit
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT228530.10144942204948341No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTGACC76750.037.5368043
TTACGCG74500.033.9400449
CGAGAAT105250.031.710099
GCCTAAC46100.031.4860022
CACGTAT85200.031.4837553
TGACCTA97600.029.168155
CTACGGG60250.027.93787836-37
ACCTGAC93500.027.7924122
GGGGGGA52650.027.568941
GTACCTA116450.026.3623377
CCCGCCG116100.026.27049494
GGGGGGG52350.026.2099511
CGCTACG65050.026.20088834-35
CGGTACC75150.026.1941815
GGGGGTA52000.025.9621471
TTTACGC101100.025.6561538
GACCTAA114200.025.4795026
AGTTCGC88550.025.4585194
AACGAGA130550.025.2744837
ACCGGGC41150.024.97419590-91