FastQCFastQC Report
Tue 15 Mar 2016
17-Normal21A1Testis_131203_L004_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename17-Normal21A1Testis_131203_L004_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22526496
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT600190.2664373544824726No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT501800.22275990016378935No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC296600.13166717096169772No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCGGGGA100100.029.2533574
CACCGGT35650.026.9287972
AGGCCGG112300.026.8387371
GCCGGGG109300.026.3826453
GCAGAGC138950.026.0296894
ATCGGAT93150.023.9606675
GGCCGGG137600.022.2934022
TCGGATG102200.022.0142026
GCTCCCC86550.021.9193554
GGTCCTC47200.021.5624853
TCCCGCA102750.020.69190290-91
TCGGTCT97100.020.66057284-85
ACCGGTG47950.020.2011953
CCCCCAG96700.020.1276457
AGATGTG264850.019.955545
CGCTATC98900.019.47390274-75
CGGATGA117600.019.3595757
CCATCGG118950.019.101143
CCCCAGG104450.018.6778628
CATCGGA121800.018.5442454