FastQCFastQC Report
Tue 15 Mar 2016
17-Normal21A1Testis_131203_L004_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename17-Normal21A1Testis_131203_L004_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences292171
Sequences flagged as poor quality0
Sequence length10-100
%GC43

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC6880.23547853825328316No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCACTAG359.3912083E-442.4224488-89
AATCGGA1351.9216077E-636.1929594
TCGGTCT1500.035.5124284-85
CTCGTCG1450.034.76400880-81
GCAGAGC2353.5652192E-1034.65282494
ATCGGAA1907.399649E-834.2880694
AGACTAG1550.033.8317864-65
TCCCGCA1403.6379788E-1232.54447690-91
CGTCGGT1600.032.36607782-83
ACGCGGG552.8740376E-432.0298584
GGTCTCC1850.031.43464586-87
GGACCGT703.320167E-530.2099191
CGCTATC1650.030.12330874-75
TAGCTTC1750.029.75233868-69
GTCGGTC1401.4551915E-1129.5918482-83
TTCGCTA1600.028.43655872-73
TCTCCCG1701.8189894E-1228.38560388-89
ACTAGCT1900.028.28211466-67
GCCGGGG3150.027.9625723
AAATCGG2000.027.93290392-93