FastQCFastQC Report
Tue 15 Mar 2016
16-Normal21A1Muscle_131203_L003_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename16-Normal21A1Muscle_131203_L003_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences19152513
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCAGGTGGGAGATTTTGATATCATTCTAAAGAACTATTTAAGTTTATAGA321070.16763857567933774No Hit
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT310950.1623546737704864No Hit
CTCTCATATAATGAAGATTAATATAATAATCCCGATTAAGGAAATAGTTG269090.14049853405660134No Hit
CATAGTTTATGTATTATGGGATTAATTAAAAAATATATAAAGTATATGAT204930.10699901365423953No Hit
ACCTCATCAATAAATTGAAATATATAAGAATAATCATACAATATCTACAA202640.10580334810371883No Hit
CTCTCGTATAATGAAGATTAATATAATAATCCCGATTAAGGAAATAGTTG198660.10372529181940772No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATAATCG122900.058.7655194
AGGTGGG77300.042.4829863
GGTGGGA87950.041.430564
GTGGGAG91100.040.5585485
GCCCCGT23700.038.152181
GGGAGAT107650.037.736657
CCCCCGA27800.037.3799551
CGTGCTC67550.034.4922494
ATCTAGA94950.033.9390569
GGAGATT120700.033.594438
CAGGTGG97150.033.478592
CTCGTCA61950.033.040133
CCCCGAT30150.031.9299412
CATCTAG100800.031.689678
TAAGCGT106750.031.67157482-83
GCAGGTG105250.031.1585371
TGGGAGA122600.030.8091726
CGTATAA71350.030.7810525
ACCTCGT49350.030.7195171
ATAAGCG110250.030.68872682-83