FastQCFastQC Report
Tue 15 Mar 2016
16-Normal21A1Muscle_131203_L003_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename16-Normal21A1Muscle_131203_L003_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences243855
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG6220.25506961103934717No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG2870.1176928912673515No Hit
CGCAACGATGATTATTTTCTACTAATCATAAAGACATTGGAACTTTATAT2710.11113161509913679No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC2520.1033400996493818No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT656.0610346E-661.54784494
GCCCGGT200.00600826354.4598122
CAGCCAT2500.052.3028683
ATGGCCT2650.051.259728
TCAGCCA2650.050.6921542
TCGCTTA200.00804177950.59057282-83
AGCCATG2650.049.342334
TGGCCTG2700.049.032059
TTCAGCC2700.048.4087221
CATGGCC2850.046.297577
CCATGGC2950.044.7004056
GCCATGG3100.043.673915
GCCCAGT350.001047009441.493192
TACTAGG350.001047009441.493191
CGCGCAT350.001274704539.8664984-85
TCGGTCT457.950565E-539.85033486-87
GCGCACA556.8336212E-638.05437584-85
TGCATCG1400.037.69227662-63
CGGCTGT1200.037.6718368-69
ATCGCGG1150.037.6515564-65