FastQCFastQC Report
Tue 15 Mar 2016
15-Normal21A1Head_131203_L003_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename15-Normal21A1Head_131203_L003_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22253685
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT918600.4127855678733657No Hit
GACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT400620.18002411735404722No Hit
AACCTGACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT312890.14060143297615654No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATAATCG118150.047.76238694
CCTGACC104450.046.862983
CTGACCT115350.042.5114674
TGACCTA120200.040.62755
GCCTAAC62600.038.848482
GACCTAA159000.031.0593326
AGGTGGG75250.029.3744753
GGTGGGA89250.027.8935744
ATAAGCG95150.027.67444682-83
TAAGCGT96150.027.3866282-83
CATCTAG90100.027.3269218
GTGGGAG90900.027.1052785
ATCTAGA92750.026.9388629
AAGCGTC103900.026.83106284-85
CGTCTGG100100.026.79726886-87
GCCCCGT28350.026.5626811
CCCCCGA33350.026.43221
CGGTACC66300.025.6661475
GCGTCTG106200.025.580386-87
AAACCCG86200.025.56109476-77