FastQCFastQC Report
Tue 15 Mar 2016
15-Normal21A1Head_131203_L003_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename15-Normal21A1Head_131203_L003_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences293606
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG3250.11069256077873067No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATCGGGC451.0024269E-650.3025490-91
CGGATCG551.0624535E-745.73972386-87
AATCGGA758.9047325E-442.86651694
AGTCGGA758.9047325E-442.86651694
GATCGGG752.2295353E-839.326888-89
ACGACCG1300.038.995445
ACCGAGC1250.037.7752848
CGACCGA1250.037.6778766
GACCGAG1300.036.2973677
ATCGCGG459.740897E-636.14484464-65
GCGGATC707.0491296E-735.9383586-87
CATGACG1300.035.8893931
GGCGGAT708.7711305E-734.94900584-85
TCGGTCT501.7221949E-434.94900584-85
TCCCGCA651.2556806E-534.8248490-91
GACGACC1350.034.571934
GGATCGG759.900341E-734.41095488-89
CCGGGGA1900.034.0120624
CCGAGCG1400.033.745389
GGCCAGG1451.7137989E-533.25850394