FastQCFastQC Report
Tue 15 Mar 2016
14-Normal6A1Testis_131203_L003_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename14-Normal6A1Testis_131203_L003_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16016686
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT845580.5279369277764451No Hit
GACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT331470.2069529239694154No Hit
AACCTGACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT256440.16010802734098675No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTGACC85150.048.2811783
GCCTAAC51050.041.6930922
TGACCTA100300.041.04855
TTACGCG56600.039.6379289
CTGACCT104300.039.62824
ACCTGAC98650.038.3168222
GACCTAA128050.032.372826
GTACCTA72800.031.3369067
CCCATAG56200.030.66126894
CGGTACC51000.030.3165785
CTGAGGG56550.030.1907888
GCCCGGT38450.028.8263852
AACCTGA93700.028.4649351
CGAGAAT79450.028.2936659
TTTACGC82050.027.5462238
AACGAGA80600.027.426657
GGGGGGA37100.027.1377431
ACCTAAG85600.026.9846129
GGTTTAC78600.026.3136226
AGTTCGC58350.025.73752694