FastQCFastQC Report
Tue 15 Mar 2016
14-Normal6A1Testis_131203_L003_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename14-Normal6A1Testis_131203_L003_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16016686
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT768480.47979962896194633No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT700340.4372564961315968No Hit
TTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGG189500.11831411316922864No Hit
AATGCTCCCCCAGGGGTATAATAAACCAAAAAACACCAAAAAAAAGTAAA175410.10951703741960102No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCTCCCC83050.031.0631944
CACCGGT30600.030.5447462
CCCCCAG92400.027.8361077
TGCTCCC94000.027.4912823
CTTAGGT62150.026.839721
CCCCAGG96550.026.6404728
CTCCCCC98550.026.373215
TCCCCCA101650.025.480466
CCCAGGG103050.025.1360369
ATGCTCC109050.023.7445812
CCGGGGA38350.023.6668594
ACCGGTG39800.023.028513
ATCGGAT71350.021.1594435
ACACCGG47700.020.9072441
GCCGGGG44350.020.6659453
TCGGATG75100.019.6217466
AGGCCGG48350.019.608741
CCGGTGA51100.018.3741974
CCATCGG87150.017.6476173
CATCGGA90850.017.175544