FastQCFastQC Report
Tue 15 Mar 2016
13-Normal6A1Muscle_131203_L003_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename13-Normal6A1Muscle_131203_L003_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences25750536
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GGTACGTTAGGAATACAGGTTAGCTAATTCAGGTAGGGAAGCTTGACAGA369280.14340672365033488No Hit
GCAGGTGGGAGATTTTGATATCATTCTAAAGAACTATTTAAGTTTATAGA286320.11118991853218123No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATAATCG154150.049.99041494
ACTGGCC114900.046.93677594
CCCCCGA35450.038.966481
CCCGCCG62350.036.5290194
GGTACGT104050.036.1566621
CGTTAGG117750.035.8505745
ACGTTAG103300.035.387234
AGGTGGG90450.035.2584233
GCCCCGT27950.035.1202431
GGTGGGA104050.034.7052734
GTGGGAG108450.033.02475
CCCCGAT35550.032.984612
GGGAGAT128000.031.615497
GTTAGGA141750.031.3920086
CCACGTA68200.029.8282742
TAAGCGT123400.029.44751582-83
CGCTACG45000.029.41838834-35
TACGTTA128100.028.987063
CAGTCCG38800.028.9071129
CTACGGG45550.028.71765336-37