FastQCFastQC Report
Tue 15 Mar 2016
13-Normal6A1Muscle_131203_L003_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename13-Normal6A1Muscle_131203_L003_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences25750536
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG1528500.5935798773276021No Hit
GCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTGG343520.13340304838703163No Hit
AGCTGGTATACCACGACGGTACTCCGATTATCCAGACGCTTATACTTCAT341120.1324710289525624No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC288360.1119821350514801No Hit
ACCGCCGTCAGTAAGATTATCTTGTGGAGAGTATAAAATTTCATTATATA267670.10394735084349313No Hit
CGATGTTGGATTAAGAAAATTATTAGGTGCAGAAGCTTAATTTATTGGTC259480.10076683452336682No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAGGAGG436500.036.9225733
AGGAGGT421950.035.887657
CCGGGGA72500.035.466384
GCCGGGG72850.035.295643
TGCAGGA450900.034.8224681
GAGGTGA445200.034.2813039
GCAGGAG477150.033.171242
GGAGGTG474950.032.229098
GGTGACC318700.028.94292310-11
CCTATTC325900.028.70674916-17
GTCATCC330850.028.63608750-51
AATTTCT667050.028.04520294
CAGGCTT369100.027.75648380-81
GGCCGGG95400.027.242212
TGACCCT347550.026.7345212-13
ACCAGGC392000.026.17377978-79
AGGCCGG101450.026.1058391
CTACCAA360550.025.96694824-25
GCGGTCT119300.025.9319694
CTCTACC363800.025.74517822-23