FastQCFastQC Report
Tue 15 Mar 2016
13-Normal6A1Muscle_131203_L003_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename13-Normal6A1Muscle_131203_L003_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences385939
Sequences flagged as poor quality0
Sequence length10-100
%GC43

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC7680.1989951779944499No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG7380.1912219288540417No Hit
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG4970.12877682742609584No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AATCGGA901.1601514E-860.55624894
GCAGAGC2300.044.00671494
GTCGGTC1050.043.92880682-83
CGCGCAT551.5793921E-743.49735684-85
CGTCGGT1200.041.1832682-83
TTCAGCC2300.039.609511
GGGCGGT1206.4279066E-638.3867192-93
TCGGTCT1400.036.61767284-85
TCGTCGG1250.035.8333180-81
GCGCGCA807.6863216E-834.17649584-85
GGGTCCA402.1392932E-433.68821364-65
AGCCATG2850.033.2226564
CCGGGGA3450.032.722654
GCCGGGG3600.032.3707923
ATGGCCT2850.032.35578
GCGCATG1302.1232678E-532.24545386-87
ACTAGCT1550.031.98441766-67
TCAGCCA2850.031.9655692
CCCCCGT702.657495E-531.2146934
ACCCCCG702.657495E-531.2146933