FastQCFastQC Report
Tue 15 Mar 2016
12-Normal6A1Head_131203_L003_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename12-Normal6A1Head_131203_L003_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences30135313
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT957310.31767050171338856No Hit
GACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT402020.13340495252197976No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATAATCG134600.040.09278594
CCTGACC116450.039.068563
GCCTAAC70450.036.425562
TGACCTA133800.034.047155
CTGACCT137150.033.203674
CCCCCGA43500.029.9962671
GCCCCGT33300.029.9106921
GACCTAA170500.026.9832576
ATAAGCG96550.025.98767382-83
CCCCGAT36900.025.8138642
TAAGCGT101050.024.2247682-83
CGGCGGT172150.023.90419690-91
CGGTACC67750.023.6335355
CGTGCTC79250.023.59553594
GGTATAT243400.023.43452594
AAACCCG97950.023.20221976-77
AAGCGTC119000.022.88043284-85
CGTCTGG108350.022.7755786-87
GCGTCTG113900.022.4870186-87
CGTATAA136000.022.2029555