FastQCFastQC Report
Tue 15 Mar 2016
12-Normal6A1Head_131203_L003_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename12-Normal6A1Head_131203_L003_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences30135313
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT962680.3194524642899843No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT811430.26926217756556897No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG581040.19281034180730097No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC442120.14671160044032064No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT50400.039.9632494
CGCAACG83700.037.840241
CGACCGA66550.031.9607056
CAGCTTA184250.031.21004394
ACCGAGC69900.030.3045628
ACCATCG91300.029.95825294
CGGACCA76000.028.8620325
ACGACCG77500.028.4180055
CCGAGCG77800.027.3997979
GACCGAG80200.026.5219887
GCAACGA133900.024.9332712
AACACGG94350.024.3037171
CATGACG95300.023.6465911
CAGGAGG276800.023.036993
GACGACC95100.022.9054374
AGCCGGG71250.022.81318974-75
GAAACCC188600.022.8027522
ATCGGGC57350.022.68783490-91
CAACGAT147550.022.114383
CGATGAT148150.021.8201946