FastQCFastQC Report
Tue 15 Mar 2016
12-Normal6A1Head_131203_L003_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename12-Normal6A1Head_131203_L003_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences304032
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA4500.14801073571203033No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCGGTT650.064.4117286-87
ACCATCG1052.8376235E-1064.3122294
CGGATTA200.007012169352.376355
AGCCGGG900.046.26925774-75
CGGTTGA1053.6379788E-1240.93979388-89
CGACCGA1050.039.985386
GCGCGGT803.7767677E-837.04346584-85
TCGGTCT803.7767677E-837.04346584-85
GTCGGTC707.08922E-735.9123282-83
CGTCGGT804.9631126E-835.91231582-83
CGGTCTC759.541E-734.57390284-85
GGTCTCC908.384268E-833.83241786-87
CATGGCC1450.033.8144657
CGGCGCG858.4584826E-833.79982882-83
GGGCGCG1103.6379788E-1133.6613478-79
ACACGGA1650.033.5920142
CCGGGCG1203.6379788E-1232.79607476-77
CGGACCA1500.032.5897255
GAAGCCG1250.032.4257672-73
ACCGAGC1305.456968E-1232.3819858