FastQCFastQC Report
Tue 15 Mar 2016
11-Wingbud23B2_131203_L003_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename11-Wingbud23B2_131203_L003_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22089619
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT284690.12887954292013817No Hit
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT275730.12482333896297623No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCCCGA36850.025.824511
GCCCCGT27550.023.4564531
CGGTACC55750.022.8750785
GCCCGGT41550.022.0511072
GGGCCGT20350.021.750371
CCGGTAC56150.021.28364
ACCTAAG92750.020.8942189
CCCGGTA50650.020.7983363
CCCCGTT51550.020.7786712
CCCCCGT38150.020.6517351
GTACCTA93150.020.5509837
GGCCCCT34600.020.212131
GCCCGTA23900.019.8160442
GGGGGGT29550.019.6220741
GCCTAAC44600.019.5507052
CCTGACC70350.019.378393
GCCCCGA23600.019.317741
GTCCCGT44000.019.2137361
CCCGTTA36700.019.176183
CCCGAAT58300.018.7525143