FastQCFastQC Report
Tue 15 Mar 2016
11-Wingbud23B2_131203_L003_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename11-Wingbud23B2_131203_L003_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22089619
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG342420.15501399096109353No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT306060.13855377043850325No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT284360.12873015147975164No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGGGGT36000.022.2754738
CCGGGGA37600.020.6172034
ACCCTAT114200.020.45012714-15
CTACGCG30750.020.1839776
ACCAGGC133700.018.86130378-79
GTCATCC126350.018.64287450-51
GCCGGGG42400.018.4941273
CAGGAGG225600.018.3921953
GAGGTGA204900.017.9991729
CCTATTC130450.017.82092916-17
CTCTACC132400.017.80289522-23
AGGAGGT211350.017.1486917
GCAGGAG240600.016.821622
GGTGACC142050.016.53728310-11
CAGGCTT157950.016.14339680-81
GGGGGTA55850.015.9002159
GTGACCC115900.015.89390812-13
GACCCTA117800.015.82969114-15
ATGCGGG52550.015.7760685
TGACCCT147750.015.71355912-13