FastQCFastQC Report
Tue 15 Mar 2016
10-Wingbud23B1_131203_L003_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename10-Wingbud23B1_131203_L003_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18371918
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG288670.1571256740858521No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGGGGT22300.022.4072028
ACCCTAT88400.021.5303314-15
CAGGAGG164650.020.8456883
CGCAACG32000.020.502561
ACCAGGC100400.020.1331778-79
GCAGGAG175850.019.3445532
GTCATCC99300.019.3414950-51
AGGAGGT161950.019.3251347
GAGGTGA165250.019.1604949
CCGGGGA29050.017.7851054
CTCTACC106950.017.67461622-23
GGAGGTG183700.017.5816758
GTGACCC89200.017.45533812-13
CCTATTC109700.017.39425316-17
GACCCTA89750.017.3006814-15
GGTGACC111500.017.29421410-11
CAGGCTT121500.016.9490380-81
CCAGGCT100250.016.85474280-81
GCCGGGG29550.016.5711883
TGACCCT115300.016.40750912-13