FastQCFastQC Report
Tue 15 Mar 2016
1-Wingbud6A2_131203_L002_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename1-Wingbud6A2_131203_L002_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20827273
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC376620.18083020278266865No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG209240.10046442469928733No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCGGGGA93800.037.4080854
GCCGGGG100000.034.8673973
GGCCGGG115000.031.4268112
CGGACCA57000.031.211375
GCAGAGC135650.030.75582794
ACCATCG70800.028.14421794
CGGGGAA126300.027.8879365
AACACGG70650.026.8467241
AGGCCGG133950.026.7465131
ACACGGA83200.023.497752
CGTCGGT93350.022.52185882-83
GAGTACG80150.022.199689
TCGGTCT96900.021.80172384-85
TCCCGCA104050.021.18142390-91
CGCTATC97700.020.85594774-75
CGGTCTC96250.020.6847484-85
TCTCCCG106650.020.4715188-89
GTCGGTC97150.020.45619882-83
GCTAGAA110150.019.99147494
CTCCCGC102750.019.92858588-89