FastQCFastQC Report
Tue 15 Mar 2016
1-Wingbud6A2_131203_L002_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename1-Wingbud6A2_131203_L002_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences292629
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC12610.4309210638726852No Hit
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA4710.1609546558953487No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCAGAGC2650.069.35506494
ACCATCG1250.066.8330694
CGTCGGT2250.046.81653282-83
AATCGGA954.438062E-543.96911694
GCTAGAA1351.6191916E-743.3177394
GGTCTCC2450.042.57937686-87
TCGTCGG2250.042.32589380-81
CGGTCTC2300.040.9834884-85
CCGGGGA6400.040.737464
TCGGTCT2600.040.4378484-85
CGCTATC2700.040.43424674-75
GTCGGTC2350.040.34190482-83
CGGGGAA6800.039.404325
TTCGCTA2700.039.36235472-73
CCGTGAC458.701301E-539.2477077
GCCGGGG6650.039.219383
ACTAGCT2600.038.9946766-67
TCTCCCG2550.038.78648488-89
CGCGGTT1350.038.6368586-87
AAATCGG1306.2184354E-638.55753794