FastQCFastQC Report
Mon 13 Mar 2017
lambdpassrer0.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamelambdpassrer0.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1973
Sequences flagged as poor quality0
Sequence length261-36002
%GC49

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA100.5068423720223011No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA60.30410542321338063No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA50.25342118601115055No Hit
GCTGTTGTGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA40.20273694880892043No Hit
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA30.15205271160669032No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA30.15205271160669032No Hit
GCGGTAGCCACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGA30.15205271160669032No Hit
CTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA30.15205271160669032No Hit
CTGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA30.15205271160669032No Hit
CTGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA20.10136847440446022No Hit
TCGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.10136847440446022No Hit
GCTGATGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.10136847440446022No Hit
CGGTATACTTCGTTCAGTTACATGTGCTGTTTTCGCATTTATCGTGAAAC20.10136847440446022No Hit
CTGGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG20.10136847440446022No Hit
TGGTATACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.10136847440446022No Hit
TCGGTATTGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.10136847440446022No Hit
CGCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.10136847440446022No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCCGCATTTATCGTGAAA20.10136847440446022No Hit
CGCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.10136847440446022No Hit
TGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.10136847440446022No Hit
GCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA20.10136847440446022No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.10136847440446022No Hit
TTTGTTGTACTTCGTTCAGTTGCATGTGCTGTTTCGCATTTATCGTGAAA20.10136847440446022No Hit
TGGTAGCCTTCGTTCAGTTACGTATTACTGTTTGCATTTATCGTGAAACG20.10136847440446022No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTAGAAA20.10136847440446022No Hit
TCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA20.10136847440446022No Hit
CGGTATACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA20.10136847440446022No Hit
GCGGTGTACTTCGTTCAGTTACATGTGCTGTTTCGCATTTATCGTGAAAC20.10136847440446022No Hit
TTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.10136847440446022No Hit
TCGGTAGCCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA20.10136847440446022No Hit
GCGGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG20.10136847440446022No Hit
GCTGTTGTGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.10136847440446022No Hit
CTGGTGTACTTCGTTCCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.10136847440446022No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCATTTATCGTGAAAC20.10136847440446022No Hit
CTGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAGC20.10136847440446022No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCTGTTA101.7231837E-4488.897431
CGCGGTA101.7231837E-4488.897431
CTGTTAT101.7231837E-4488.897432
GTAGCCG101.7231837E-4488.897435
GCTGTTG202.5948993E-6366.673071
TGTTATA155.807517E-4325.931643
TTATACT155.807517E-4325.931645
GTAGCCT155.807517E-4325.931643
AGCCTTC155.807517E-4325.931645
CGGTATG402.8740033E-10305.560883
TACTTCG356.226219E-8279.369968
GCCTTCG200.0013746489244.448726
TATACTT200.0013746489244.448726
TGGTAGC200.0013746489244.448721
CCGTTTC200.0013746489244.448729
GGTAGCC200.0013746489244.448722
TACTTCC200.0013746489244.448727
GTTATAC200.0013746489244.448724
GGTATGC551.9390427E-9222.226094
ACTTCGT452.1809865E-7217.287739