FastQCFastQC Report
Mon 13 Mar 2017
all.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenameall.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3647
Sequences flagged as poor quality0
Sequence length261-43807
%GC49

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA100.2741979709350151No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA80.21935837674801206No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA50.13709898546750754No Hit
GCTGTTGTGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA40.10967918837400603No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC40.10967918837400603No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TACTTGT101.7669896E-4490.736086
ACTTGTT101.7669896E-4490.736087
AAAGTAC101.7669896E-4490.736081
GATGTAC202.7516307E-6368.052064
GGTGTAC451.8189894E-12327.157443
CTTGTTC155.9548626E-4327.15748
TATGCTG155.9548626E-4327.15744
TGTTGTG155.9548626E-4327.15742
TCGGTGT303.2065145E-8327.15741
GGTAGCC155.9548626E-4327.15743
GTGTACT550.0312.286624
TTGTGCT256.707516E-6294.441684
TTGTACT256.707516E-6294.441685
TGTTGTA256.707516E-6294.441683
GTAGCCG256.707516E-6294.441684
GTTGTAC256.707516E-6294.441684
TATACTT256.707516E-6294.441684
CGGTGTA356.919436E-8280.420622
TGGTATG301.3887311E-5245.368061
ATACTTC200.0014094579245.368045