FastQCFastQC Report
Wed 8 Mar 2017
batch_1488933081701.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamebatch_1488933081701.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1565
Sequences flagged as poor quality0
Sequence length262-35639
%GC39

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA50.3194888178913738No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA40.25559105431309903No Hit
TTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA40.25559105431309903No Hit
TCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA40.25559105431309903No Hit
TGGTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA40.25559105431309903No Hit
CTGGTATACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA30.19169329073482427No Hit
CGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA30.19169329073482427No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA30.19169329073482427No Hit
TCTGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA30.19169329073482427No Hit
TGGTATGCTTCGTTCAGTTACATATTGCTGTTTCGCATTTATCGTGAAAC20.12779552715654952No Hit
TCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA20.12779552715654952No Hit
CGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.12779552715654952No Hit
CGCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.12779552715654952No Hit
TGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.12779552715654952No Hit
GCTGATGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.12779552715654952No Hit
AAAGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC20.12779552715654952No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.12779552715654952No Hit
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.12779552715654952No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.12779552715654952No Hit
TGATACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC20.12779552715654952No Hit
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCATTTATCGTGAAA20.12779552715654952No Hit
TGGTATACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.12779552715654952No Hit
CGCGGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.12779552715654952No Hit
CGCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.12779552715654952No Hit
TTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.12779552715654952No Hit
TCGGTGTGCCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.12779552715654952No Hit
CGCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.12779552715654952No Hit
CTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA20.12779552715654952No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GATATGC101.701745E-4487.548374
GCTGATA101.701745E-4487.548371
GCGTTCA101.701745E-4487.548379
CTGTTGT101.701745E-4487.548372
CGGTATA101.701745E-4487.548371
GTATACT202.5147056E-6365.66133
GGTATAC202.5147056E-6365.66132
TTGTTGT155.7354174E-4325.032261
CTGATAT155.7354174E-4325.032262
TTTGTTG155.7354174E-4325.032261
TATACTT256.1306528E-6292.529024
TGTTGTA200.0013576186243.774192
TGATATG200.0013576186243.774193
ATACTTC301.2694369E-5243.774195
GGTATGC200.0013576186243.774192
GTATGCT250.0026479182195.019353
ATGCTTC250.0026479182195.019355
ACTTCGT751.128501E-8162.516139
TGCTTCG456.3990294E-5162.516136
GTACTTC509.739204E-5146.264517