FastQCFastQC Report
Wed 8 Mar 2017
batch_1488929586344.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamebatch_1488929586344.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2122
Sequences flagged as poor quality0
Sequence length244-30587
%GC39

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA80.3770028275212064No Hit
CTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA50.23562676720075398No Hit
CGCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA50.23562676720075398No Hit
CGCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA40.1885014137606032No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA40.1885014137606032No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC40.1885014137606032No Hit
GCTGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA40.1885014137606032No Hit
TCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA30.1413760603204524No Hit
TGCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA30.1413760603204524No Hit
CGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA30.1413760603204524No Hit
CTGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA30.1413760603204524No Hit
TCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA30.1413760603204524No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TGGTAAC101.7433941E-4487.928562
CGGTATA101.7433941E-4487.928563
CGGTGTA202.6461075E-6365.94643
GCTGGTG155.8755634E-4325.285741
GCGGTGT155.8755634E-4325.285742
CTGGTAA155.8755634E-4325.285741
CGCGGTA155.8755634E-4325.285741
CTTCCGT155.8755634E-4325.285749
TGCGGTG200.0013907402243.964281
GGTGTAC401.2484634E-7243.964284
TACTTCG1050.0209.112248
GGTATGC352.4707399E-5209.112242
ACTTCGT1100.0199.607159
TGGTATA250.0027124158195.171421
GTGTACT503.7985592E-7195.171425
CGCTTCG250.0027124158195.171428
TGGTGTA250.0027124158195.171422
TGTACTT754.9112714E-11195.171426
GTACTTC807.6397555E-11182.97327
ATACTTC404.2087268E-5182.97325