FastQCFastQC Report
Wed 8 Mar 2017
batch_1488926183090.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamebatch_1488926183090.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1772
Sequences flagged as poor quality0
Sequence length238-31112
%GC39

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC60.33860045146726864No Hit
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA50.28216704288939054No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA40.2257336343115124No Hit
CGCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA40.2257336343115124No Hit
CGCGGTGTGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA40.2257336343115124No Hit
CGCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA40.2257336343115124No Hit
CTGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA40.2257336343115124No Hit
TCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA40.2257336343115124No Hit
CGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC30.16930022573363432No Hit
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA30.16930022573363432No Hit
CTGGTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA30.16930022573363432No Hit
TGGTATACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC30.16930022573363432No Hit
TGGTATACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA20.1128668171557562No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.1128668171557562No Hit
AACATTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.1128668171557562No Hit
CGCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.1128668171557562No Hit
GCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA20.1128668171557562No Hit
GCTGTTATACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.1128668171557562No Hit
CTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA20.1128668171557562No Hit
GTGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA20.1128668171557562No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA20.1128668171557562No Hit
TGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.1128668171557562No Hit
CTTGTTGTGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.1128668171557562No Hit
CTGGTATGCTTCGTTCAGTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.1128668171557562No Hit
CTGATGTACTTCGTTCAGTTACGTATTGCTGTTTCATTTATCGTGAAACG20.1128668171557562No Hit
GCTGTTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.1128668171557562No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TGTTGTG157.870385E-7491.971443
CGGTATA101.6756571E-4491.971443
GTTGTGC101.6756571E-4491.971444
CTGATGT251.09012035E-8393.577122
TGTTGTA202.4838519E-6368.978583
GATGTAC202.4838519E-6368.978584
GCTGTTG202.4838519E-6368.978581
GCTGATG202.4838519E-6368.978581
ACGGTAT202.4838519E-6368.978582
GTTGTAC202.4838519E-6368.978584
TTGTACT302.7086571E-8327.980965
GTACTTC600.0327.980967
TCTGTTG155.647468E-4327.980961
CTGTTGT302.7086571E-8327.980962
TGTACTT650.0302.751656
ACTTCGT750.0295.182869
TACTTCG750.0295.182868
TTGTTGT200.0013367946245.985722
TTGTGCT200.0013367946245.985725
CGGTATG200.0013367946245.985723