FastQCFastQC Report
Wed 8 Mar 2017
batch_1488923428867.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamebatch_1488923428867.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2469
Sequences flagged as poor quality0
Sequence length214-37803
%GC39

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA110.44552450384771164No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC100.4050222762251924No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA50.2025111381125962No Hit
CTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA40.16200891049007696No Hit
CGCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA40.16200891049007696No Hit
TCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA40.16200891049007696No Hit
TGGTAGCCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC30.12150668286755771No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA30.12150668286755771No Hit
TCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA30.12150668286755771No Hit
CGCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA30.12150668286755771No Hit
CCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA30.12150668286755771No Hit
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCATTTATCGTGAAAC30.12150668286755771No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTGT101.7626827E-4487.857122
CTGTTAC101.7626827E-4487.857122
GTAATAC101.7626827E-4487.857125
TGTGTAC101.7626827E-4487.857123
TGTTACT155.9404765E-4325.23813
GCTGTTA155.9404765E-4325.23811
GCTGATG155.9404765E-4325.23811
CGCGGTG155.9404765E-4325.23811
TAATACT155.9404765E-4325.23816
GCCGTTC155.9404765E-4325.23818
GGTAATA155.9404765E-4325.23814
TTGTACT403.1832315E-10304.91075
GTTGTAC403.1832315E-10304.91074
TGGTATG256.5941204E-6292.714261
GTGTACT256.5941204E-6292.714264
GTACTTC700.0278.77557
TGTTGTA456.4392225E-10271.031743
GCGGTAT200.0014060824243.928561
CCGTTCA200.0014060824243.928569
ATGCTTC301.3652996E-5243.928566