FastQCFastQC Report
Wed 8 Mar 2017
batch_1488917721143.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamebatch_1488917721143.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1745
Sequences flagged as poor quality0
Sequence length281-28069
%GC39

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA70.40114613180515757No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA60.3438395415472779No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC60.3438395415472779No Hit
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA50.28653295128939826No Hit
GCGGTATACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA30.17191977077363896No Hit
TCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA30.17191977077363896No Hit
CGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA30.17191977077363896No Hit
TGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC30.17191977077363896No Hit
GCTGTTGTACTTCGTTCAGTTACGTATTACTGTTTTCGCATTTATCGTGA30.17191977077363896No Hit
GCTGTTGTGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA30.17191977077363896No Hit
CTGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA20.1146131805157593No Hit
TTCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.1146131805157593No Hit
TCGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.1146131805157593No Hit
TGGTAGCCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.1146131805157593No Hit
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAC20.1146131805157593No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.1146131805157593No Hit
TGGTATTACTTCGTTCAGTTACGTATTATGTTTCGCATTTATCGTGAAAC20.1146131805157593No Hit
TACGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.1146131805157593No Hit
GCTGATACTTCGTTCAGTTACGTATTGCTGTTTTCATTTATCGTGAAACG20.1146131805157593No Hit
TGGTATACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.1146131805157593No Hit
CGCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.1146131805157593No Hit
CGCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCATTTATCGTGAAA20.1146131805157593No Hit
GCGGTAGCCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA20.1146131805157593No Hit
GCGGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC20.1146131805157593No Hit
TGGTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA20.1146131805157593No Hit
CAGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAACG20.1146131805157593No Hit
CTGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA20.1146131805157593No Hit
GCTGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.1146131805157593No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTTCGT101.740792E-4485.323558
CTGTTGT101.740792E-4485.323552
TATGCTT202.6084672E-6363.992655
GCTGTTG202.6084672E-6363.992651
GCCTTCG155.866902E-4323.5497
CGCGGTG155.866902E-4323.5491
GTATGCT256.359076E-6291.194124
GGTATGC256.359076E-6291.194123
GTTGTAC256.359076E-6291.194124
TGGTATG200.0013887152242.661771
GCGGTGT200.0013887152242.661772
CGGTGTG200.0013887152242.661773
GGTAATA200.0013887152242.661772
TTGTACT301.3167013E-5242.661765
TGTTGTA352.4358067E-5207.99583
ATGCTTC250.0027085165194.129415
TGTACTT503.6724123E-7194.129416
GTGTGCT250.0027085165194.129415
GCTTCGT404.1493397E-5181.996329
GGTGTGC300.004673728161.77454