FastQCFastQC Report
Wed 8 Mar 2017
batch_1486772656326.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filenamebatch_1486772656326.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3764
Sequences flagged as poor quality0
Sequence length255-30014
%GC39

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAACG150.3985122210414453No Hit
TTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG90.2391073326248672No Hit
TCGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC70.18597236981934112No Hit
TTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC70.18597236981934112No Hit
GCTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC70.18597236981934112No Hit
CTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC60.1594048884165781No Hit
TCGTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA60.1594048884165781No Hit
TGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC50.1328374070138151No Hit
TCATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC50.1328374070138151No Hit
CTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG50.1328374070138151No Hit
CGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC50.1328374070138151No Hit
TCATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAACG50.1328374070138151No Hit
GCTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG50.1328374070138151No Hit
ATGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC40.10626992561105207No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC40.10626992561105207No Hit
CGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA40.10626992561105207No Hit
TTTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGCT40.10626992561105207No Hit
CGGTATTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA40.10626992561105207No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA40.10626992561105207No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACTTCCG101.7737795E-4490.386666
CTGCTTC155.9777236E-4326.924442
TTGTGCT155.9777236E-4326.924442
TATGCGC155.9777236E-4326.924444
GGTATGC155.9777236E-4326.924442
GCCGTTC155.9777236E-4326.924446
ATGTACT403.45608E-10306.491671
TCGTTCG456.9849193E-10272.437048
TGTACTT750.0261.539552
AATCAGT200.0014148637245.193334
CTGTACT200.0014148637245.193331
TACTTCC200.0014148637245.193335
CATGCTT301.3974577E-5245.193333
CGTTCGG401.3595127E-7245.193339
TCATACT301.3974577E-5245.193331
GCATGCT200.0014148637245.193332
TACTTCG1250.0235.385594
ACTTCGT1200.0224.760565
AAATCAG250.0027593528196.154653
CTTCCGT250.0027593528196.154657