FastQCFastQC Report
Wed 8 Mar 2017
batch_1486762594695.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filenamebatch_1486762594695.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4000
Sequences flagged as poor quality0
Sequence length250-32922
%GC39

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAACG100.25No Hit
TCATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC100.25No Hit
TTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG100.25No Hit
TGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC90.22499999999999998No Hit
ATGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC90.22499999999999998No Hit
TTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC90.22499999999999998No Hit
CTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC80.2No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC80.2No Hit
GCTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC80.2No Hit
CAATACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAACG60.15No Hit
TCGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC60.15No Hit
TACATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG50.125No Hit
ACATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC50.125No Hit
CTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC50.125No Hit
GCTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG50.125No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTGTACT252.0008883E-11490.56251
CGCTGGT101.776394E-4490.56255
CATACTT351.5643309E-10350.40182
TCATACT351.5643309E-10350.40181
CTTGTAC155.9865165E-4327.041661
GGCAGCC155.9865165E-4327.041661
GCTGGTT155.9865165E-4327.041666
AGCGCTG155.9865165E-4327.041663
GCAGCCT155.9865165E-4327.041662
GCGCTGG155.9865165E-4327.041664
ATACTTC457.057679E-10272.53473
TACTTCG1700.0245.281254
CAGCCTT200.0014169399245.281253
CTGGTTC200.0014169399245.281256
AGCCTTC200.0014169399245.281254
ACGTACT200.0014169399245.281252
TGGTATG200.0014169399245.281251
GGTTCAG301.4026276E-5245.281238
ACTTCGT1800.0231.65455
TTGTACT552.3446773E-9222.982942