FastQCFastQC Report
Wed 8 Mar 2017
batch_1486752610586.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filenamebatch_1486752610586.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4000
Sequences flagged as poor quality0
Sequence length295-37637
%GC39

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC160.4No Hit
TGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC120.3No Hit
CTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAACG110.27499999999999997No Hit
TCATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAACG80.2No Hit
CTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG70.17500000000000002No Hit
ATGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC60.15No Hit
CTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC50.125No Hit
TTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC50.125No Hit
GTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC50.125No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC50.125No Hit
TCATACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC50.125No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA50.125No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AACGTAC101.7570014E-4492.362521
GCTGCTT101.7570014E-4492.362521
CCATGCT101.7570014E-4492.362521
GGTATGC202.7388614E-6369.271882
ATCGTTT155.921193E-4328.24177
GGTATTA155.921193E-4328.24172
CGGTATG155.921193E-4328.24171
CTGTGCT155.921193E-4328.24172
TCATGCT256.6763605E-6295.41751
AGCCTTC256.6763605E-6295.41752
CATGCTT456.91216E-10273.534732
TCGTTCC301.3822753E-5246.181268
GCCTTCG301.3822753E-5246.181263
CTACTTC200.0014014866246.181262
TTACTTC200.0014014866246.181266
TAGCCTT200.0014014866246.181261
AACGCTG200.0014014866246.181261
ACGCTGG200.0014014866246.181262
ACATGCT200.0014014866246.181262
ACGTACT301.3822753E-5246.181262