FastQCFastQC Report
Tue 14 Mar 2017
allr1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filenameallr1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences39764
Sequences flagged as poor quality0
Sequence length248-39374
%GC39

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC1070.26908761693994565No Hit
CTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAACG1060.26657277939845087No Hit
TTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG710.17855346544613218No Hit
TTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC650.16346444019716327No Hit
CTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG640.16094960265566843No Hit
CTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAAC620.1559199275726788No Hit
TCATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAACG620.1559199275726788No Hit
ATGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC620.1559199275726788No Hit
TGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC570.1433457398652047No Hit
TCATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC530.13328638969922543No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC510.12825671461623578No Hit
TCGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC460.1156825269087617No Hit
ATGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAACG430.10813801428427725No Hit
TCATACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACGC400.10059350165979278No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GGTATGC2200.0300.827732
TCATGCT2150.0273.621061
CCGTACT650.0263.974151
CTGTACT3100.0260.932981
GCGTAGC200.0014687259245.118871
GGCAGCC601.6370905E-11245.118851
CGGTATG1150.0234.461531
CATGCTT4100.0227.183362
GTATGCT2100.0221.774223
TATGCTT2150.0216.616674
ATACTTC4550.0210.101883
TCATACT2100.0210.101881
CAGCCGC950.0206.41591
AGCCGCT1000.0196.09512
TGGTATG2250.0196.09511
TACTTCG13950.0191.526574
CATACTT3200.0183.839142
ACTTCGT14550.0183.628575
ACATGCT2300.0181.174822
TTGTACT3400.0180.234472