FastQCFastQC Report
Mon 13 Mar 2017
all_mtrc.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenameall_mtrc.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1368
Sequences flagged as poor quality0
Sequence length261-36002
%GC49

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA80.5847953216374269No Hit
GCTGTTGTGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA40.29239766081871343No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA40.29239766081871343No Hit
GCGGTAGCCACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGA30.21929824561403508No Hit
CTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA30.21929824561403508No Hit
GCTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA30.21929824561403508No Hit
CTTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA30.21929824561403508No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAAA30.21929824561403508No Hit
TCGGTATTGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.14619883040935672No Hit
GCTGATGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.14619883040935672No Hit
TGGTAGCCTTCGTTCAGTTACGTATTACTGTTTGCATTTATCGTGAAACG20.14619883040935672No Hit
GCGGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAACG20.14619883040935672No Hit
TCGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.14619883040935672No Hit
CTGGTGTACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA20.14619883040935672No Hit
GCTGTTGTGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAA20.14619883040935672No Hit
GCGGTGTACTTCGTTCAGTTACATGTGCTGTTTCGCATTTATCGTGAAAC20.14619883040935672No Hit
CGCGGTATGCTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGA20.14619883040935672No Hit
GCGGTGTACTTCGTTCAGTTACGTATTGCTGTTTTCGCATTTATCGTGAA20.14619883040935672No Hit
CTGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAGC20.14619883040935672No Hit
TGGTATACTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.14619883040935672No Hit
TCGGTAGCCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAA20.14619883040935672No Hit
TGGTATGCTTCGTTCAGTTACGTATTGCTGTTTCGCATTTATCGTGAAAC20.14619883040935672No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTGTACT101.7104679E-4484.259284
GCGGTAT101.7104679E-4484.259282
GCTGTTA101.7104679E-4484.259281
CGCGGTA157.9356323E-7484.259251
TGTTGTA155.7648885E-4322.83952
TATACTT155.7648885E-4322.83955
GTATTAC155.7648885E-4322.83955
TGTTATG155.7648885E-4322.83953
GTATACT155.7648885E-4322.83954
TATTACT155.7648885E-4322.83956
ATACTTC155.7648885E-4322.83956
GGTATTA155.7648885E-4322.83954
GTTATGC155.7648885E-4322.83954
GGTATAC155.7648885E-4322.83953
GTTGTAC155.7648885E-4322.83953
TTATGCT200.0013646123242.129645
TTACTTC200.0013646123242.129648
GCTGGTA200.0013646123242.129641
ATTACTT200.0013646123242.129647
TGTACTT401.1215707E-7242.129645